Data Sheet: Activity – DNA Electrophoresis

All Content is Copyright Protected and May NOT Be Posted or Shared Outside Of The Classroom

NameCourseDate
   

Activity Data Code KCR

Plant 1 DNA SequencePlant 2 DNA SequencePlant 3 DNA Sequence
TCAGCGTGACTAACTGTCATCGTCGCTAACGTTGATCGACGCTAACGA

Procedure I – DNA Fragment Size

In the table below indicate which sample contains the smallest DNA fragment and which sample contains the largest DNA fragment. Note: Sample 1 is in Lane 1 of the gel, etc.


Lane 1 FragmentLane 2 FragmentLane 3 FragmentLane 4 FragmentLane 5 Fragment
2nd LargestLargestMiddleSmallest2nd Smallest

Observations and Questions

[1] What is the composition of a DNA fragment? That is, what is a DNA fragment made of?

[2] Using the lane numbers on the electrophoresis instrument, list the samples from smallest DNA fragment to largest DNA fragment. Label the largest and smallest.

[3] What accounts for the different final locations of the different size DNA fragments? That is, why do different sized DNA fragments end at different locations on the electrophoresis instrument?

ORDER NURSING COURSE WORKS HERE

Procedure II – Crime Scene DNA

A student returns home after a quick trip to the grocery store and finds that his apartment has been burglarized. Crime scene investigators collect samples from the apartment, the student, and a set of three suspects.

In the table below indicate the number of DNA fragments each sample has in common with the crime scene sample (Lane 2). Note: Sample 1 is in Lane 1 of the gel, etc.

Tip: It is helpful to use a ruler when attempting to match up DNA fragments in the gel. A bank/ATM/credit card works well too.

Lane 1 StudentLane 2 Crime SceneLane 3 SuspectLane 4 SuspectLane 5 Suspect
36013

Observations and Questions

[4] Does the crime scene sample contain bands in common with the student? Explain why or why not.

[5] Which suspect (if any) CANNOT be excluded from suspicion? Explain your answer.

Procedure III – Paternity Case

One female dolphin and three male dolphins live together in a seaside research facility located in the Caribbean. The female has recently given birth to a healthy calf and you have been tasked to determine which male dolphin is the father.

In the table below indicate the number of DNA fragments each sample has in common with the child/calf sample (Lane 2). Note: Sample 1 is in Lane 1 of the gel, etc.

Tip: It is helpful to use a ruler when attempting to match up DNA fragments in the gel. A bank/ATM/credit card works well too.

Lane 1 MotherLane 2 CalfLane 3 MaleLane 4 MaleLane 5 Male
26300

Observations and Questions

[7] Which sample is from the father of the calf? Explain your answer.

[8] How many bands does the calf have in common with its mother? How many bands does the calf have in common with its father? Propose a plausible explanation for the number of bands from each parent.

[9] After adding the probe and filter, what additional information have you learned about the genotype of the calf?

[10] Given that the probe pairs with a specific DNA strand in the matrix, what can you conclude about the nucleotide sequence of the Baby’s DNA fragment that pairs with the probe sequence?

[11] Discuss reasons that it might be useful to find out whether a newborn carries a specific gene or allele.

Procedure IV – Species DNA Comparison

While on an expedition a botanist discovers an unknown plant species. She suspects that the unknown species may be related to other known plant species. You will determine the DNA sequence of a portion of chloroplast DNA (cpDNA) from the unknown plant and compare it the sequences from three known plants (see the Activity Form tab for this data).

Observations and Questions

[12] In your own words, explain why it is necessary to include only one chain-terminating/synthesis-terminating nucleotide in each well of the electrophoresis instrument.

[13] Determine the DNA sequence by analyzing the location of each nucleotide across the four lanes of the electrophoresis instrument. Provide the DNA sequence as your answer here.

Important: remember that your sequence starts from the shortest fragment!

[14] What is the significance of finding that DNA sequences are highly similar for two different species?

[15] Below, align the newly determined DNA sequence with the sequences of the three known plant species (see data under the Activity Form tab). Next, compute the percent alignment of the bases for the three comparisons.

Show the alignment and percent alignment calculation for Plant 1. Highlight the Plant 1 differences in yellow.

Show the alignment and percent alignment calculation for Plant 2. Highlight the Plant 2 differences in yellow.

Show the alignment and percent alignment calculation for Plant 3. Highlight the Plant 3 differences in yellow.

Which known species has a genotype that is most similar to that of the unknown plant?

[16] A biologist at World University used Procedure IV to conduct an additional study and found the sequence following below. Using your knowledge of central dogma generate the amino acid sequence that results from this sequence.

Given DNA sequence: CAC GAC GGA TTC GTA

Data Sheet: Activity – Ecology

All Content is Copyright Protected and May NOT Be Posted or Shared Outside Of The Classroom

NameCourseDate
   

Activity Data Code KCR

Procedure I – Mushroom Yield – Nitrate Concentration

Complete the table below using your data and information found under the Background tab


TrialNitrate Concentration Level (ppm)Mushroom Yield (Number of Mushrooms)
11.05
210.031
335.045
450.045

Observations and Questions

[1] For Procedure I, what are the independent, dependent, and control variables?

[2] Plot the data that you entered into Procedure I Table. What type graph will you use and why?

[3] Describe the trend for mushroom yield as the nitrate concentration is increased.

[4] Write a hypothesis statement about the relationship between the number of mushrooms and nitrate concentration in the soil.

Procedure II – Mushroom Yield – Heavy Metal Concentration

Complete the table below using your data and information found under the Background tab

TrialMetal Concentration Level (ppm)Mushroom Yield (Number of Mushrooms)
10.0045
20.5034
31.0023
41.5012

Observations and Questions

[5] Plot the data that you entered into Procedure II Table.

[6] Describe the trend for mushroom yield as the concentration of heavy metals in the soil is increased.

[7] Write a hypothesis statement about the relationship between the number of mushrooms and the concentration of heavy metals in the soil.

[8] What is the purpose of holding the nitrate concentration and the pH level at constant values for the four test levels of heavy metal concentrations?

[9] A local researcher would like to check a new species of mushrooms for whether they can be used for bioremediation of heavy metals at a local hazardous waste site. Using the same experimental parameters as in Procedure II, provide hypothetical data (mushroom yields) in Table 9 (see below) that could serve as evidence that this new species of mushroom is weaker at taking up and accumulating toxic heavy metals. Explain the reasoning for your decision about the hypothetical data.

Question 9, Table 9, Hypothetical Data
TrialMetal Concentration Level (ppm)Mushroom Yield (Number of Mushrooms)
10.00 
20.50 
31.00 
41.50 

Procedure III – Mushroom Yield – pH Dependence

Complete the table below using your data and information found under the Background tab

TrialpH LevelMushroom Yield (Number of Mushrooms)
15.06
26.027
37.045
48.027

Observations and Questions

[10] For Procedure III, what are the independent, dependent, and control variables?

[11] Plot the data that you entered into Procedure 3 Table. What type graph will you use and why?

[12] Describe the trend for mushroom yield as soil pH level increased.

[13] Write a hypothesis statement about the relationship between the number of mushrooms and soil pH.

[14] Considering the food web, which trophic levels would be impacted by lower yields of fungi (mushrooms) due to, for example, acid rain? Explain your reasoning.